DNAConverter
DNAConverter is made and published by makoto amijima. AppBrain is an independent app data site and isn't affiliated with makoto amijima. The app name, icon, screenshots and description belong to makoto amijima and are shown as published on the App Store.
AppBrain's verdict
- Last updated
- November 19, 2025
- Size
- 1.27 MB
User feedback
Ratings and reviews on the App StoreComments on DNAConverter for iOS
We don't have enough comments to show example comments. Please check back later.
Store listing
By makoto amijima, from the App Store
Description by makoto amijima Written by the developer, not by AppBrain. Click to read.
This app lets you hide those feelings inside ATCG.
If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.
■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!
Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”
■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.
■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever
Even the words you can’t say out loud might feel lighter when you hide them in ATCG.
Safety and technology
Found in the app by AppBrain- Price
- $0.99
- App size
- 1.27 MB
- Content rating
- Everyone
Technologies used by DNAConverter
Releases
Updates seen on the App Store- Version
- 2.0.0
- Launched
- January 2020
No changelog data
Alternatives
Similar apps and more from makoto amijimaAlternatives to DNAConverter
More from makoto amijima
Rankings
App Store top chartsApp Store Rankings for DNAConverter
About the app and developer
About DNAConverter
DNAConverter is an utilities app developed by makoto amijima.
User Ratings
The app has no ratings yet.
App Information
DNAConverter costs $0.99. The app size is 1.27 MB. The latest version available is 2.0.0. The last update was on November 19, 2025.
Technical Requirements
The app has a content rating of Everyone. The app has been available on the App Store since January 2020.
Developer information for makoto amijima
Address: