DNAConverter

2.0.0

makoto amijima

0.00

0 reviews

$0.99

Download from the App Store

Alternative downloads for the DNAConverter app

About DNAConverter

DNAConverter is an overall app developed by makoto amijima.

Download Statistics

User Ratings

The app has no ratings yet.

App Information

DNAConverter costs $0.99 to download. The APK download size is 1.27 MB. The latest version available is 2.0.0. The last update was on November 19, 2025.

Technical Requirements

The app has a content rating of Everyone. The app has been available on Google Play January 2020.

Description

Want to say something, but also… not really?
This app lets you hide those feelings inside ATCG.

If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.

■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!

Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”

■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.

■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever

Even the words you can’t say out loud might feel lighter when you hide them in ATCG.

Show more Show less

More data about DNAConverter

Price	$0.99
Rating	No ratings
Ranking	Not ranked
Version	2.0.0
App download size	1.27 MB
Suitable for	Everyone

Changelog of DNAConverter

No changelog data

Show more Show less

Developer information for makoto amijima

makoto amijima

N/A

Comments on DNAConverter for iOS

We don't have enough comments to show example comments. Please check back later.

App Store Rankings for DNAConverter

This app is not ranked

Technologies used by DNAConverter

Today's trending apps Top new apps Apps on sale Popular Overall Apps other people are watching

AppBrain is a directory focused on discovering great apps and games. We give statistics, rankings and search options that Google Play and the App Store don't have. All trademarks are owned by their respective owners. AppBrain doesn't offer APKs or binaries, and always lets users install the official version from Google Play or the App Store.

More apps